Chest ACCP Education Calendar
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Guest Access | Sign In via User Name/Password
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Article Archive
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagesh, B. S.
Right arrow Articles by Arora, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagesh, B. S.
Right arrow Articles by Arora, S. K.
(Chest. 2001;119:1737-1741.)
© 2001 American College of Chest Physicians

Evaluation of Polymerase Chain Reaction for Detection of Mycobacterium tuberculosis in Pleural Fluid*

Babu S. Nagesh, MD; Shobha Sehgal, MD; Surinder K. Jindal, MD, FCCP and Sunil K. Arora, PhD

* From the Departments of Pathology (Dr. Nagesh), Internal Medicine (Dr. Jindal), and Immunopathology (Drs. Sehgal and Arora), Postgraduate Institute of Medical Education and Research, Chandigarh, India.

Correspondence to: Sunil K. Arora, PhD, Department of Immunopathology, Postgraduate Institute of Medical Education and Research, Chandigarh, 160012, India; e-mail sunilkarora@ glide. net.in


   Abstract
TOP
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Objectives: Tuberculosis, a reemergent killer, is threatening to assume serious proportions all over the world, particularly in view of the AIDS pandemic. The detection of mycobacterial DNA by polymerase chain reaction (PCR) in clinical samples is a promising approach for the rapid diagnosis of tuberculous infections. The aims of this study were to evaluate PCR for detection of Mycobacterium tuberculosis in pleural fluids and to correlate the results with adenosine deaminase activity (ADA) estimation and acid-fast bacilli (AFB) screening.

Methods: The sensitivity and specificity of PCR in detection of mycobacterial DNA in 20 samples of tuberculous pleural effusion were evaluated using 40 samples of nontubercular pleural effusion as controls. The results were correlated with the ADA in all 60 pleural fluids. In addition, AFB detection by Ziehl-Neelsen staining on cytospin smears of all pleural fluids was also compared.

Results: Of the 20 samples of tuberculous pleural effusion, mycobacterium could be detected by AFB staining in 4 samples. Fourteen samples were PCR positive. None of the samples from the control group were AFB or PCR positive. The sensitivity of PCR, therefore, was 70.0% with specificity of 100% (positive predictive value, 100%; negative predictive value, 86.95%). The sensitivity of AFB screening was at best 20%. The mean of ADA values in tubercular pleural effusions was 63.21 U/L (SD, 33.01), and the mean in the control samples was 51.1 U/L (SD, 29.71). Taking a cut-off value of 50 U/L, both the sensitivity and specificity of ADA estimation in diagnosing tuberculosis were only 55%.

Conclusion: PCR represents a rapid and sensitive method for the detection of mycobacterial DNA in tuberculous pleural effusions. AFB screening has low sensitivity, and ADA estimation has both low sensitivity and specificity. Therefore, when the clinical suspicion is high and smear result is negative, but the signs and symptoms of M tuberculosis are apparent, PCR is the method of choice for identifying the infection.

Key Words: acid-fast bacilli • adenosine deaminase activity • Mycobacterium tuberculosis • pleural fluids • polymerase chain reaction


   Introduction
TOP
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Statistics released by the World Health Organization on World Tuberculosis Day, March 24, 1998, indicate that there are 8 million new cases of tuberculosis each year in the world. In India, 200,000 people contract active tuberculosis every year (ie, four every minute) and 500,000 people die of tuberculosis every year (ie, 0.1 every minute), accounting for 28.4% of global tuberculosis (World Health Organization Global Tuberculosis Programme Estimates).

Improved case detection and effective treatment are two of the key factors mandatory for better control of mycobacterial diseases. The laboratory diagnosis of tuberculosis is based on the traditional method of Ziehl-Neelsen acid-fast bacilli (AFB) stain and on laboratory culture of the causative organism, Mycobacterium tuberculosis. Ziehl-Neelsen stain, although rapid and inexpensive, lacks sensitivity. The culture, although sensitive (10 to 100 viable organisms per sample),1 takes a long period to complete, and clinical and therapeutic decisions have to be made before the laboratory diagnosis becomes available. Culture techniques also require viable organisms, and this is often a problem in partially treated patients. Because of the shortcomings of these traditional methods, several rapid detection methods have been developed, such as DNA probes, and the BACTEC system (Johnston Laboratories Inc; Towson, MD), etc.2 3 4 5 6 However, none of these meet the requirement of rapidity, sensitivity, and specificity, and they often require sophisticated equipment and highly trained personnel.

The polymerase chain reaction (PCR) can specifically amplify discrete fragments of DNA in which target material is present in only picogram quantities. It is now a well-developed technique and has been used extensively for the diagnosis of numerous infectious diseases.7 8 9 10 11 The major benefits of this rapid diagnostic test are improved patient care, reduced medical costs, and more effective use of isolation rooms. In this study, we have evaluated the efficacy of PCR for detection of mycobacterial DNA in pleural fluids and correlated the results with adenosine deaminase activity (ADA) values of the same pleural fluid along with a comparison to the traditional AFB screening method by Ziehl-Neelsen staining.


   Materials and Methods
TOP
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Patients and Pleural Fluid
The population under study comprised 60 patients with pleural effusion. The study period was from July 1997 to December 1998. Any patient coming to the outpatient department within the study period with pleural effusion and with no other specific clinical history for disease, such as lung cancer, and who had not received any antituberculous treatment (ATT) was included in the study. Pleural fluid was aspirated from these patients and transported to the laboratory for investigation.

Study Design
The study was done prospectively in a blinded manner in which the clinical diagnosis was not available to the laboratory personnel performing the PCR. Each pleural fluid sample received in the laboratory was divided into two parts. One part was microcentrifuged for 20 min. The supernatant was taken for ADA estimation and the pellet for DNA extraction. The other sample was used for cytospin smear preparation on which Ziehl-Neelsen staining was done. ADA estimation was done by the method of Giusti (1974).12

The final clinical diagnosis in each case was retrieved from the case files of the medical record library of our hospital only at the time of analysis of data. The results of the PCR were not known at the time of clinical assignment of cases. Subsequently, the cases were grouped under tuberculous (20 cases) and nontuberculous (40 cases) pleural effusion based on the following criteria. Cases were included in tuberculous group (Table 1 ) if (1) patients received a diagnosis of pulmonary tuberculosis made on the basis of histologic findings, such as granulomatous inflammation consistent with tuberculosis in fine-needle aspiration cytology (FNAC) material from lymph nodes or pleural biopsy; and/or (2) patients received a diagnosis of pulmonary tuberculosis made on the basis of AFB staining from sputum, BAL/FNAC/pleural fluid; and or (3) patients having a chest radiograph strongly suggestive of pulmonary tuberculosis with a therapeutic response to ATT even in absence of sputum positivity. All other cases not in the above category were grouped as nontuberculous pleural effusions, which included cases of disseminated carcinoma (n = 6), liver disease with portal hypertension (n = 6), lymphoma (n = 4), congestive cardiac failure (n = 5), systemic lupus erythematosus (n = 2), and others.


View this table:
[in this window]
[in a new window]

  		Table 1.. Modalities Employed for Diagnosis of Tuberculosis*

 
DNA Extraction
A pellet from a centrifuged pleural fluid sample was resuspended in 500 µL Tris ethylenediaminetetra-acetic acid (EDTA) (10 mM Tris x 1 mM EDTA, pH 8.0), 50 µL lysozyme (10 mg/mL) added and incubated at 37°C for 2 h. Seventy microliters of 10% sodium dodecyl sulfate (SDS) and 6 µL of proteinase K (10 ng/mL) were added and incubated at 65°C for 1 h. Later, DNA was isolated from the pellet by cetyltrimethylammonium bromide/chloroform extraction process.13

Primers
The primers used for the amplification of a conserved repetitive sequence in the M tuberculosis DNA were primer I (5' GACACCTCATCGGCACCCGC 3') and primer J (5' GCCATGCGATGTCATAAG 3'), which amplify a specific 150-base pair (bp) product in the PCR.14

PCR
A typical PCR reaction mixture contained 1 x PCR buffer, 1.5 mM MgCl2, 200 mM each of deoxynucleoside triphosphates (ie, deoxyadenosine triphosphate, deoxycitadine triphosphate, deoxyguanosine triphosphate, and deoxythymidine triphosphate), 0.5 mM each of primer I and primer J, and 0.5 U of Taq DNA polymerase enzyme (Boehringer Mannheim; Mannheim, Germany). The DNA from the clinical samples was added and volume made up with autoclaved distilled water. Each set of PCR reactions contained a positive control containing 1.0 pg. DNA from H37Rv strain of M tuberculosis and two negative controls, one containing the same amount of DNA extracted from lymphocytes of healthy individuals, and the other containing the same amount of autoclaved water. The thermal cycler (Model 480; Perkin-Elmer; Norwalk, CT) was programmed for 35 cycles with initial denaturation at 94°C for 10 min, denaturation at 94°C for 1 min, annealing at 56°C for 1 min, extension at 72°C for 1 min, and final extension at 72°C for 10 min.

Post-PCR Detection
The contents after the PCR were once extracted with chloroform, and the amplified product was detected by (1) gel electrophoresis and (2) dot hybridization (Fig 1 , 2). Fifteen microliters of the amplified product was electrophoresed on a 2% agarose gel in 0.5 x Tris-borate-EDTA buffer at a pH of 8.6. The gel was stained with ethidium bromide (5 µg/mL), and the 150-bp amplified band was visualized on an ultraviolet transilluminator (Model 3-1000; Fotodyne; New Berline, WI).



View larger version (93K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1.. Gel electrophoresis showing PCR-amplified product of 150 bp (arrow).

 
Two microliters of the amplified product was blotted onto a strip of nitrocellulose paper (NCP) (Advanced Microdevices [P]) Ltd.; Ambala Cantt, India), air dried, denatured and neutralized, and finally baked at 80°C in a vacuum oven for 2 h to immobilize the DNA onto the NCP. The NCP was incubated with hybridization buffer containing 6 x sodium chloride-sodium citrate (SSC), 5 x Denhardt’s solution with 100 µg/mL sheared and denatured salmon sperm DNA and 0.5% SDS for 2 h at 60°C in a water bath with shaking. The amplicon probe (ie, the DNA isolated from the 150-bp amplified band obtained after PCR from H37RA mycobacteria) was labeled with 32P-deoxycitadine triphosphate by random prime labeling technique,6 heat denatured, and added to the hybridization buffer, and the incubation was further carried on at 60°C overnight. The NCP was washed after the incubation, three times with 2 x SSC/0.5% SDS at room temperature for 5 min each wash, once with 0.2 x SSC/0.5% SDS at 60°C for 5 min, air dried, and exposed to radiograph film for 48 to 72 h at - 70°C. The positively amplified sample showed a dark signal as compared to no signal in the negative samples.


   Results
TOP
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Sixty samples of pleural effusion were obtained for this study from the outpatient unit of the Department of Pulmonary Medicine, Postgraduate Institute of Medical Education and Research, Chandigarh, India. Twenty samples were tubercular pleural effusion, and 40 samples were nontubercular pleural effusion. The latter were obtained as a disease control group. The ages of the patients with tubercular pleurisy (study group) ranged from 6 to 70 years and included 9 female (45%) and 11 male patients (55%). Patients in the control group were 11 to 70 years old and included 15 female (37.5%) and 25 male patients (62.5%).

Of the tuberculous samples, four tested positive for AFB. In one sample, a single AFB was detected after a long search. Considering all the modalities of histologic diagnosis (pleural biopsy, BAL, sputum and pleural fluid examination), a total of eight samples were AFB positive. Thus, pleural fluid missed 50% of microscopically positive samples. Of the 20 samples from the tuberculosis patients (study group), 14 were PCR positive. None of the samples from the control group were AFB or PCR positive. Therefore, the sensitivity of PCR in this study was 70% with a specificity of 100%. The positive predictive value (PPV) was 100%, and the negative predictive value (NPV) was 86.95%. The {chi}2 was applied, and the results showed a p < 0.01. The sensitivity of AFB screening was at best 20% with specificity of 100% (PPV, 100%; NPV, 71.2%). The sensitivity of AFB screening would be much lower in the routine day-to-day screening, since we were able to find very occasional single bacilli after extensive search by two independent observers.

The mean of ADA values in tubercular pleural effusions was 63.21 U/L (SD, 33.01), and the mean of ADA values of control group was 51.1 U/L (SD, 29.71). To test the significance of the difference between the study and the control groups, an unpaired t test was applied and the result showed significance at p < 0.01. It is clear from Table 2 that 10 patients had an ADA value of <= 50 U/L. Thus, taking a cut-off value of 50 U/L, both the sensitivity and the specificity of ADA in diagnosing tuberculosis were only 55%.


View this table:
[in this window]
[in a new window]

  		Table 2.. Summary of Results

 

   Discussion
TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Traditional methods of diagnosing tuberculosis have been isolation of bacilli in culture or recognition of AFB in clinical specimens. AFB staining lacks sensitivity. So far, the "gold standard" has been culture. But with a dividing time of 48 h, it takes up to 10 weeks using the culture method. Besides, microscopy-positive specimens fail to yield mycobacterium on culture, perhaps due to harsh chemical treatment used in decontamination or the presence of nonviable mycobacterium in partially treated patients. No more than 85% of cases of tuberculosis confirmed by the US Centers for Disease Control and Prevention are culture positive.15 In addition, the specificity of culture has been questioned because laboratory contamination can produce false-positive results. Thus, even culture fails as a "gold standard."

In aspirates from tuberculous pleural effusions, organisms are rarely seen following Ziehl-Neelsen staining, and a bacterial culture finding in one study16 was positive in only 20 to 30% of patients. The fluid collects as a result of a delayed hypersensitivity reaction to tuberculous proteins.17 In our study, of a total of 20 samples, four samples showed AFB positivity, which gives a sensitivity of 20%.

Adenosine deaminase is an enzyme involved in purine catabolism found in most cells, but particularly in lymphocytes where its concentration is inversely related to the degree of differentiation. High levels of ADA were found in patients with tuberculous pleurisy. At a level of 50 U/L, the sensitivity and specificity claimed for identification of tuberculosis are 90% and 89%, respectively.18 Levels of ADA show a significant correlation with number of CD4+ lymphocytes in pleural effusion. False-positive test results are therefore found in patients with rheumatoid disease, chronic lymphatic leukemia, and undifferentiated lymphoma. Neutrophils contribute to the high level of ADA found in empyema fluid.19 Therefore, many serious doubts have been cast on the usefulness of ADA levels in the detection of tuberculous pleurisy.20 21

In our study, the mean of ADA values for tuberculous pleural effusion was 63.21 U/L (SD, 33.01) and that of nontuberculous pleural effusion was 51.1 U/L (SD, 29.71). Both sensitivity and specificity together were maximum at a cut-off value of 50 U/L and amounted to 55% each. None of our tuberculosis patients had coexisting diseases such as rheumatoid arthritis or chronic lymphatic leukemia, etc. Since the patients were randomly included in the control group, there was no bias. However, these results are in contrast to another study.20

PCR is being evaluated for diagnosis of a number of diseases, including detection of infectious agents.7 8 9 10 11 Because mycobacterial detection is hampered by the difficulties noted earlier, PCR is being widely considered as an alternative tool that is both rapid and highly sensitive. An additional advantage is its high specificity, which helps in identifying the specific mycobacterial strain.

In our study, pleural fluids were processed in batches (8 to 10 specimens) that included a DNA-free control. In order to minimize the risk of contamination with exogenous M tuberculosis DNA, these procedures were performed using disposable tubes and pipettes. In addition, a sample blank was taken through all the preparation steps to detect possible contamination. Reagents were prepared using autoclaved deionized distilled water from a laboratory in which no mycobacterial work was being done, and were autoclaved prior to use. Furthermore, pre-PCR, PCR, and post-PCR procedures were performed in different laboratories.

The results showed that mycobacterial DNA was amplified in 14 of the 20 patients with tubercular pleurisy. Although there is possibility of a false-positive PCR finding due to the presence of old healed tuberculosis infection in a patient having nontubercular effusion due to other diseases, none of the patients in our control group showed PCR positivity, showing our assay system for pleural fluids to be quite specific. Thus, PCR shows a sensitivity of 70% and specificity of 100% along with a PPV of 100%. Although an NPV of 86.95% does indicate that a negative PCR does not absolutely rule out a tuberculous infection, a positive PCR result means the patient definitely has tuberculosis. The results suggest that the PCR is more sensitive than other existing methods, but still not nearly good enough to identify all cases. The results are not surprising considering the fact that pleural effusion in patients with tuberculosis mainly occurs as a result of a delayed hypersensitivity reaction to tuberculous proteins, and the presence of bacilli in pleural fluid is not always necessary.17 All of the patients with positive PCR results had responded very well to ATT. It was shown in a previous study22 that patients with inflammatory uveitis who were treated with ATT based on a PCR test result showed resolution of inflammation with no recurrence for 2 years of follow-up.

Negative PCR results seen in six patients may be due either to inhibitors of Taq polymerase that are particularly high in pleural fluids or to sampling difficulties. The chance of detecting mycobacterium becomes higher with a bigger sample size. Since we had taken only 2 mL per patient, a small sample size may have affected the results to some degree. However, whenever the result was positive, the mycobacterial load must have been sufficiently high.

In conclusion, AFB screening is not a useful method for pleural effusions because of its low sensitivity. Considering the fact that a meticulous prolonged search was carried out in our study by two independent observers, day-to-day practice may show lower sensitivity. Estimation of ADA activity, although claimed to be a useful screening test for picking up tubercular pleural effusion cases, does not seem to reflect the same in our study. It failed to pick up 50% of the tuberculosis cases. In tuberculous pleural effusions, which are frequently due to a hypersensitivity reaction to tuberculous proteins, bacillary load may be extremely low and thus PCR is the method of choice for detecting the organism because of its high sensitivity and specificity.



View larger version (116K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2.. Dot hybridization box numbers 6, 7, 10, 12, and 19 are positive controls put up in various batches. Box numbers 1, 9, 14, 15, and 23 are negative controls.

 

   Footnotes
 
Abbreviations: ADA = adenosine deaminase activity; AFB = acid-fast bacilli; ATT = antituberculous treatment; bp = base pair; EDTA = ethylenediaminetetra-acetic acid; FNAC = fine-needle aspiration cytology; NCP = nitrocellulose paper; NPV = negative predictive value; PCR = polymerase chain reaction; PPV = positive predictive value; SDS = sodium dodecyl sulfate; SSC = sodium chloride-sodium citrate

Received for publication November 29, 1999. Accepted for publication January 24, 2001.


   References
TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hobby, GL, Holman, AP, Iseman, MD, et al (1973) Enumeration of tubercle bacilli in sputum of patients with pulmonary tuberculosis. Antimicrob Agents Chemother 4,94-104[Abstract/Free Full Text]
  2. Daniel, TM (1987) New approaches to the rapid diagnosis of tuberculous meningitis. J Infect Dis 155,599-602[ISI][Medline]
  3. French, GL, Chan, CY, Cheung, SW, et al (1987) Diagnosis of pulmonary tuberculosis by detection of tuberculostearic acid in sputum by using gas chromatography-mass spectrometry with selected ion monitoring. J Infect Dis 156,356-362[ISI][Medline]
  4. Eisenach, KD, Crawford, JT, Bates, JH (1988) Repetitive DNA sequences as probes for Mycobacterium tuberculosis. J Clin Microbiol 26,2240-2245[Abstract/Free Full Text]
  5. Pao, CC, Lin, SS, Wu, SY, et al (1988) The detection of mycobacterial DNA sequences in uncultured clinical specimens with cloned Mycobacterium tuberculosis DNA probes. Tubercle 69,27-36[CrossRef][ISI][Medline]
  6. Patel, RJ, Piessens, WF, David, JR, et al (1989) A cloned DNA fragment for identification of Mycobacterium tuberculosis. Rev Infect Dis 11,411-419
  7. Brisson-Noel, A, Aznar, C, Chureau, C, et al (1991) Diagnosis of tuberculosis by DNA amplification in clinical practice evaluation. Lancet 338,364-366[CrossRef][ISI][Medline]
  8. Cousins, DV, Witton, SD, Francis, BR, et al (1992) Use of polymerase chain reaction for rapid diagnosis of tuberculosis. J Clin Microbiol 30,255-258[Abstract/Free Full Text]
  9. Clarridge, JE, III, Shawar, RM, Shinnick, TM, et al (1993) Large scale use of polymerase chain reaction for detection of Mycobacterium tuberculosis in a routine mycobacteriology laboratory. J Clin Microbiol 31,2049-2056[Abstract/Free Full Text]
  10. Del Portillo, P, Marillo, LA, Potarroyo, ME (1991) Amplification of species-specific DNA fragment of Mycobacterium tuberculosis and its possible use in diagnosis. J Clin Microbiol 29,2163-2168[Abstract/Free Full Text]
  11. De Wit, D, Steyn, L, Shoemaker, S, et al (1990) Direct detection of Mycobacterium tuberculosis in clinical specimens by DNA amplification. J Clin Microbiol 28,2437-2441[Abstract/Free Full Text]
  12. Giusti, G (1974) Adenosine deaminase. Bergmeyer, HU eds. Methods of enzymatic analysis ,1092-1099 Academic Press New York, NY.
  13. Arora, SK, Kumar, B, Sehgal, S (2000) Development of a polymerase chain reaction dot-blotting system for detecting cutaneous tuberculosis. Br J Dermatol 142,72-76[CrossRef][ISI][Medline]
  14. Kaul, M, Varma, A, Tyagi, JS (1994) A highly sensitive non-radioactive method for the detection of Mycobacterium tuberculosis DNA. Biochemical 11,28-29
  15. Catanzaro, A (1996) Value of direct amplified test for diagnosis of tuberculosis. Lancet 347,1500-1501[CrossRef][ISI][Medline]
  16. Berger, HW, Mejia, E (1973) Tuberculous pleurisy. Chest 63,88-92[Abstract/Free Full Text]
  17. Allen, JC, Apicella, MA (1968) Experimental pleural effusions as a manifestation of delayed hypersensitivity to tuberculin PPD. J Immunol 101,481-487[Abstract/Free Full Text]
  18. Piras, MA, Gakis, C, Budroni, M, et al (1978) Adenosine deaminase activity in pleural effusions: an aid to differential diagnosis. BMJ 2,1751-1752
  19. Bothamley, GH (1995) Tuberculous pleurisy and adenosine deaminase. Thorax 50,593-594[ISI][Medline]
  20. Van Kierapema, ARJ, Slaats, EH, Wagenaar, JMP (1987) ADA: not diagnostic for tuberculous pleurisy. Eur J Respir Dis 71,15-18[ISI][Medline]
  21. Maartens, G, Bateman, ED (1991) Tuberculous pleural effusions: increased culture yield with bedside inoculation of pleural fluid and poor diagnostic value ADA. Thorax 46,96-99[Abstract]
  22. Gupta, V, Arora, SK, Gupta, A, et al (1998) Management of presumed intra-ocular tuberculosis: possible role of polymerase chain reaction. Acta Opthalmol Scand 76,679-682[CrossRef][ISI][Medline]



This article has been cited by other articles:


Home page
 ChestHome page
A. Gopi, S. M. Madhavan, S. K. Sharma, and S. A. Sahn
Diagnosis and Treatment of Tuberculous Pleural Effusion in 2006
Chest, March 1, 2007; 131(3): 880 - 889.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Microbiol.Home page
S. Chakravorty, M. K. Sen, and J. S. Tyagi
Diagnosis of Extrapulmonary Tuberculosis by Smear, Culture, and PCR Using Universal Sample Processing Technology
J. Clin. Microbiol., September 1, 2005; 43(9): 4357 - 4362.
[Abstract] [Full Text] [PDF]

Home page
 ChestHome page
R. S. Wiener, P. Della-Latta, and N. W. Schluger
Effect of Nucleic Acid Amplification for Mycobacterium tuberculosis on Clinical Decision Making in Suspected Extrapulmonary Tuberculosis
Chest, July 1, 2005; 128(1): 102 - 107.
[Abstract] [Full Text] [PDF]

Home page
 ChestHome page
N. A. Hasaneen, M. E. Zaki, H. M. Shalaby, and A. S. El-Morsi
Polymerase Chain Reaction of Pleural Biopsy Is a Rapid and Sensitive Method for the Diagnosis of Tuberculous Pleural Effusion
Chest, December 1, 2003; 124(6): 2105 - 2111.
[Abstract] [Full Text] [PDF]

Home page
 ChestHome page
D. M. Lima, J. K. B. Colares, and B. A. L. da Fonseca
Combined Use of the Polymerase Chain Reaction and Detection of Adenosine Deaminase Activity on Pleural Fluid Improves the Rate of Diagnosis of Pleural Tuberculosis
Chest, September 1, 2003; 124(3): 909 - 914.
[Abstract] [Full Text] [PDF]

Home page
 ChestHome page
M. Falguera, A. Lopez, A. Nogues, J. M. Porcel, and M. Rubio-Caballero
Evaluation of the Polymerase Chain Reaction Method for Detection of Streptococcus pneumoniae DNA in Pleural Fluid Samples
Chest, December 1, 2002; 122(6): 2212 - 2216.
[Abstract] [Full Text] [PDF]

Home page
 ChestHome page
D. Jimenez, G. Diaz, E. Perez-Rodriguez, and S. Arora
Diagnosis of Pleural Tuberculosis
Chest, March 1, 2002; 121(3): 1005 - 1005.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Article Archive
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (28)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nagesh, B. S.
Right arrow Articles by Arora, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nagesh, B. S.
Right arrow Articles by Arora, S. K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS