Chest
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Guest Access | Sign In via User Name/Password
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Article Archive
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yeh, C.-H.
Right arrow Articles by Lin, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yeh, C.-H.
Right arrow Articles by Lin, P. J.
(Chest. 2004;125:228-235.)
© 2004 American College of Chest Physicians

Differential-Display Polymerase Chain Reaction Identifies Nicotinamide Adenine Dinucleotide-Ubiquinone Oxidoreductase as an Ischemia/Reperfusion-Regulated Gene in Cardiomyocytes*

Chi-Hsiao Yeh, MD; Jong-Hwei S. Pang, PhD; Yi-Cheng Wu, MD; Yao-Chang Wang, MD; Jaw-Ji Chu, MD, FCCP and Pyng Jing Lin, MD, FCCP

* From the Division of Thoracic and Cardiovascular Surgery (Drs. Yeh, Wu, Wang, Chu, and Lin), Chang Gung Memorial Hospital; and Graduate Institute of Clinical Medical Sciences (Dr. Pang), Chang Gung University, Taoyuan, Taiwan.

Correspondence to: Pyng Jing Lin, MD, FCCP, Division of Thoracic and Cardiovascular Surgery, Chang Gung Memorial Hospital, 5 Fu-Hsing St, Kweishan, Taoyuan, Taiwan; e-mail: L0688{at}cgmh.org.tw


   Abstract
TOP
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Objective: Cardiac ischemia/reperfusion-induced oxidative damage often occurs in mitochondria. We identified differentially expressed genes in the canine heart after global cardiac ischemia/reperfusion injury was induced during cardiopulmonary bypass (CPB).

Methods: Differential-display polymerase chain reaction (ddPCR) was performed on cardiac tissue from canine hearts with or without global cardiac ischemia/reperfusion injury induced during CPB. Ischemia/reperfusion-associated mitochondrial injury was investigated at the protein level using various cardioplegic solutions and Western blot analysis.

Results: A mitochondrial protein nicotinamide adenine dinucleotide (NADH):ubiquinone oxidoreductase gene was identified on ddPCR. The NADH:ubiquinone oxidoreductase gene was up-regulated in canine hearts after 60 min of global cardiac ischemia/reperfusion injury during CPB. Western blot analysis revealed that, after manipulation with different cardioplegic solutions, increased Bcl-2 expression and decreased cytochrome c expression were associated with cardiomyocytic apoptosis.

Conclusions: The NADH:ubiquinone oxidoreductase gene is up-regulated during global cardiac ischemia/reperfusion injury during CPB in canines. To our knowledge, involvement of this gene in global cardiac ischemia/reperfusion injury during CPB has not been described previously. The NADH:ubiquinone oxidoreductase gene may have a role in the regulation of molecular changes during the global cardiac ischemia/reperfusion injury during CPB, such as the up-regulation of Bcl-2, which might block release of cytochrome c from the mitochondria and prevent cardiomyocytic apoptosis.

Key Words: apoptosis • ischemia/reperfusion injury • mitochondria • nicotinamide adenine dinucleotide:ubiquinone oxidoreductase


   Introduction
TOP
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
The use of cardioplegic solution during cardiopulmonary bypass (CPB) surgery is known to contribute to postoperative inflammatory tissue injury and myocardial dysfunction.1 The inflammatory response incorporates at least two effects: activation of blood components by the bypass apparatus, and myocardial ischemia-reperfusion injury, resulting from the cardioplegic cardiac arrest that is induced during CPB surgery. Myocardial dysfunction, including cardiomyocytic apoptosis resulting from the inflammatory tissue injury after cardiac surgery, contributes to postoperative morbidity and mortality.2 3

Investigations from our group and others4 5 6 7 have demonstrated that the inflammatory process after CPB is accompanied by cardiomyocytic apoptosis and alterations in gene expression. Our previous study4 showed that various cardioplegic solutions had different effects on the occurrence of cardiomyocytic apoptosis. However, the possible gene expression and molecular mechanism of cardioplegic protection is unclear. We used differential-display polymerase chain reaction (ddPCR) to identify other induced genes in canine hearts subjected to CPB with various cardioplegic solutions in myocardial ischemia-reperfusion. This method is a powerful tool designed to detect different patterns of gene expression in different injury or stimulation conditions of the same cell type. Phenotypic changes in cardiomyocytes during global cardiac arrest with various modes of cardioplegia protection should allow the detection of different patterns of gene expression.

One of the genes isolated by ddPCR was the mitochondrial nicotinamide adenine dinucleotide (NADH):ubiquinone oxidoreductase gene, a mitochondrial respiratory chain gene located in the inner membrane of mitochondria. Long periods of ischemia can alter the electron transport complexes. All of the complexes show a reduction in their activity with structural damage to the subunits after 60 min of warm ischemia, but complexes I and III appear to be the most sensitive to ischemic injury.8 Apoptosis is induced by activation of intracellular proteins (caspases) and inhibited by antiapoptotic proteins such as members of the Bcl-2 family, which blocked the release of cytochrome c from the external mitochondrial membrane.9 10 The ddPCR results prompted us to characterize expression of the related mitochondrial proteins Bcl-2 and cytochrome c9 10 11 12 in myocardium subjected to CPB and associated ischemia-reperfusion using various cardioplegic solutions to induce cardiac arrest.


   Materials and Methods
TOP
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animal Model of Global Cardiac Ischemia Using CPB
The experimental model has been described before.4 Briefly, healthy mongrel dogs (25 to 30 kg) of either sex were anesthetized with sodium pentobarbital, 30 mg/kg IV, and then administered intermittent boluses of pentobarbital, 5 mg/kg, and diazepam, 5 mg, as needed. Each dog was intubated and received ventilation with a respirator. After right thoracotomy, the pericardium was opened and tented to cradle the heart. The aorta was cannulated for aortic perfusion after heparinization (250 U/kg). The upper and lower caval veins were transatrially cannulated for venous return. CPB was instituted with a flow rate at 50 mL/kg/min. After stabilization, the ascending aorta was cross-clamped (in groups 2, 3, and 4). Cardioplegic solution was delivered via the aortic root with simultaneous measurement of infusion pressure, which was maintained at 40 to 60 mm Hg. The ascending aorta was cross-clamped for 60 min. All animals received humane care in compliance with the 1985 National Institutes of Health guidelines for the care and use of laboratory animals.

Experimental Protocol
Dogs were randomly classified into four groups with six dogs in each group as follows: group 1, the body temperature during CPB was kept at approximately 37°C, and cardioplegic solution was not used; group 2, the body temperature during CPB was kept at approximately 28°C, and continuous tepid (28°C) blood cardioplegic solution was infused into the aortic root; group 3, the body temperature during CPB was kept at approximately 28°C, and cold (4°C) blood cardioplegic solution was infused into the aortic root every 20 min; and group 4, the body temperature during CPB was kept at approximately 28°C, and cold (4°C) crystalloid cardioplegic solution was infused into the aortic root every 20 min.

In groups 2, 3, and 4, cardioplegic solutions (10 mL/kg) were delivered for induction of cardiac arrest. The cardioplegic solution was reinfused (4 mL/kg) at 20-min intervals during global ischemia in groups 3 and 4. In groups 2 and 3, blood cardioplegic solution was delivered as a mixture of four parts oxygenated blood to one part crystalloid solution. In Group 4, cold crystalloid cardioplegic solution (Plegisol; Abbott Laboratories; North Chicago, IL) was infused with systemic hypothermia (28°C). Initial induction of cardiac arrest was accomplished using 20 mEq/L potassium blood cardioplegic solution and followed continuous infusion of 8 mEq/L potassium blood cardioplegic solution during the aortic cross-clamping period.

After 60 min of aortic cross-clamping, the infusion of cardioplegic solution was stopped, the cross-clamp was removed, and systemic rewarming to 37°C was achieved. Then CPB was discontinued, and the mean arterial pressure was brought to approximately 50 mm Hg. The hearts were reperfused for another 4 h in the working state before excision.

ddPCR
For ddPCR, messenger RNA (mRNA) was isolated using the single-step extraction method.13 mRNA (50 µg) was incubated at 37°C for 30 min with 10 U of deoxyribonuclease I (Boehringer Mannheim; Indianapolis, IN). After extraction with acid-phenol-chloroform, the supernatant was precipitated in the presence of 0.3 mol/L ethanol. RNA was re-dissolved in diethyl pyrocarbonate-treated water. mRNA concentration was determined by spectrophotometry.

ddPCR was performed using the Delta Differential Display Kit (Clontech Laboratories; Palo Alto, CA) according to manufacturer specifications. {alpha}-33P deoxyadenosine triphosphate was obtained from Amersham Life Science (Cleveland, OH). Polyadenylated RNA (0.1 µg) was used for reverse transcription in a 20 µL of reaction volume. Polymerase chain reactions (PCRs) were done using the Perkin-Elmer amplification system (Wellesley, MA) using cycling parameters of 94°C for 1 min, 60°C for 1 min, and 68°C for 2 min for 30 cycles, followed by 68°C for 7 min. Amplified complementary DNA (cDNA) was then separated on a 5% DNA sequencing gel. The DNA sequencing gel was blotted onto a piece of Whatmann 3-mm paper (Kent, UK) without methanol-acetic acid fixation. After developing the film, cDNA bands of interest were assigned according to commercial primers (eg, P3T4-1) and located by cutting through the film. The gel slice was incubated in 100 µL of distilled H2O for 10 min. After rehydration of the polyacrylamide gel, cDNA was diffused out by boiling the gel slice for 15 min in a tightly capped microcentrifuge tube. cDNA was recovered by ethanol precipitation in the presence of 0.3 mol/L NaOAc with 5 µL of 10 mg/mL glycogen as a carrier and redissolved in 10 µL of water. Eluted cDNA probe (2 µL) was reamplified using the same primer set and PCR conditions as in the mRNA display except no isotope was added. PCR samples (30 µL) were run on 2% agarose gel and stained with ethidium bromide.

Sequencing was performed with the Thermo Sequenase radiolabeled terminator cycle sequencing kit (Amersham Life Science; Little Chalfont, UK). Sequences derived were directly queried against the National Center for Biotechnology Information databases using the basic local alignment search tool algorithm. A match was defined as >= 96% identity of bases over a stretch of >= 100 bases.

Reverse Transcription PCR
For reverse transcription PCR (RT-PCR), RNA was extracted from the cardiac specimens using the single-step method13 and the concentration was determined by spectrophotometry. Reverse transcription (RT) was done using 2 µL of RNA in a reaction containing 50 mM Tris, pH 8.3, 75 mM KCl, 3 mM MgCl2, 1 mM each of deoxynucleoside triphosphate, 0.25 µg each of oligo-deoxythymidine and random hexamer, 20 U of human placental ribonuclease inhibitor (Rnasin; Promega Biochemicals; Madison, WI), and 400 U of RT (Superscript II; Life Technologies; Rockville, MD). The reaction was incubated at 42°C for 90 min and then inactivated at 90°C for 5 min.

PCR reactions for NADH:ubiquinone oxidoreductase and glyceraldehyde phosphate dehydrogenase (GAPDH) were done in a 25-µL reaction consisting of 1 µL of cDNA, 10 x PCR reaction buffer (Gibco BRL; Grand Island, NY), 2.5 mM each of deoxynucleoside triphosphate, 1.125 mM MgCl2, and 1 mM primers, and 0.625 U of Taq polymerase with equal amounts of Taq antibody and 4 x Taq antibody buffer (Clontech Laboratories). Reactions were run at 94°C for 45 s, 60°C for 45 s, and 72°C for 1 min 30 s for 30 cycles, followed by 5 min at 72°C. At the same time, reactions were also performed without RT to exclude DNA contamination. Two NADH:ubiquinone oxidoreductase gene-specific sense and antisense primers (29 mer and 22 mer, respectively) were designed to hybridize to the detected fragment. Identified signal intensity of specific PCR products bands were normalized with that of GAPDH PCR product to correct for differences in manipulation and expressed as an increase-fold of mRNA expression above baseline values.

Western Blot Studies
Tissue levels of Bcl-2 and cytochrome c protein were determined by Western blot analysis as described previously.4 Ten percent (weight/volume) tissue homogenate was prepared in the STE buffer (0.32 mol/L sucrose, 5 mmol/L Tris, 2 mmol/L ethylenediaminetetra-acetic acid, 1 mmol/L phenylmethylsulfonyl fluoride, 5 mmol/L benzamidine, and 20 µg/mL leupeptin), then centrifuged at 4°C and 14,000 µg for 10 min. Eighty µg of protein from the supernatant was separated on a 15% polyacrylamide denaturing gel and then electroblotted onto Hybond-C nitrocellulose membranes (Amersham Life Science). Membranes were blocked and probed with a monoclonal anti-Bcl-2 and anti-cytochrome c antibodies (PharMingen; San Diego, CA) at 1:1,000 dilution for 2 h. Primary antibody binding was revealed using an anti-rabbit peroxidase conjugate (Dako; Carpinteria, CA) for 1 h and the ECL Chemiluminescent Detection System (Amersham Life Science). The membranes were incubated for 1 min with ECL detection solution, and the levels were determined using an ECL detection kit (Amersham Life Science). The immunoreactive bands were quantified by digital densitometric imaging (Kodak 1D Image Analysis Software; Kodak; New Haven, CT).

Data Analysis
Data are expressed as mean ± SEM. Data were entered into Excel software (Microsoft Corporation; Redmond, WA) and analyzed by the Statistical Package for the Social Science (Version 8; SPSS; Chicago, IL). One-way analysis of variance followed by the Tukey multiple comparison procedure was used to compare differences among groups; p < 0.05 was considered statistically significant.


   Results
TOP
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
ddPCR revealed a different pattern of gene expression among different groups (Fig 1 ). We noted > 50 fragments differentially expressed between groups 1 and 4. After cloning and sequencing, a gene of special interest was determined. Sequence alignment of a 184-base-pair (bp) fragment proved to be a match to the human NADH:ubiquinone oxidoreductase ß subcomplex, 8-kd gene (NDUFB2) with an overall homology of 87.0% (Fig 2 ).



View larger version (90K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1.. ddPCR. Arrow indicates differentially expressed gene amplified with commercial kit using the forward (P3) and backward (T4) primers (P3T4-1). Gr = group.

 


View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2.. Sequence alignment of canine amplicon unknown sequence (P3T4-1) and human NADH:ubiquinone oxidoreductase gene ß complex, 8 kd (NDUFB2).

 
RT-PCR of RNA from the tissue specimens used for ddPCR and of other groups confirmed the presence and differential up-regulation of the NADH:ubiquinone oxidoreductase gene among groups in canine myocardial tissue. NADH:ubiquinone oxidoreductase primers were designed as 5'TGTTCATAATCAGGAAGGATACCTAGTTC 3' (sense) and 5'GCATATTGAGCCCGGTATAGA 3' with a 200-bp-predicted product. RT-PCR detected minimal NADH:ubiquinone oxidoreductase gene mRNA in cardiac tissue from groups 1 and semiquantitative analysis implied twofold up-regulation in group 2 compared with group 1 (Fig 3 ). A significant up-regulation in NADH:ubiquinone oxidoreductase gene mRNA was observed in group 2 (8.2-fold increase compared with group 1, p < 0.01), group 3 (10.1-fold increase compared with group 1, p < 0.01), and group 4 (11.1-fold increase compared with group 1, p < 0.01). The differences of mRNA up-regulation between groups 2, 3, and 4 were also statistically significant (p < 0.05). DNA contamination was excluded by PCR of the same samples without previous RT. Sequencing the resulting band showed complete identity with the sequence from the differentially expressed band.



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3.. RT-PCR analysis shows up-regulation of NADH:ubiquinone oxidoreductase gene in cardiac tissue from different groups. Sequenced NADH:ubiquinone oxidoreductase gene ß complex, 8 kd (NDUFB2), are bands at 200 bp. GAPDH served as the loading control. The PCR products of GAPDH and NADH:ubiquinone oxidoreductase gene were designed to be 200 bp. *p < 0.05 compared with group 1. See Figure 1 legend for expansion of abbreviation.

 
The relative abundance of cell survival-regulating factors encoded by the Bcl-2 gene family can strongly affect the decision to undergo apoptosis in response to an external signal.14 The antiapoptotic Bcl-2 proteins have been identified in the myocardium; evidence suggests that several of these proteins are regulated following ischemic stress.15 16 17 The release of Bcl-2 during ischemia/reperfusion injury from the outer membrane of mitochondria has been proved to prevent apoptosis by blocking the release of cytochrome c from the mitochondria.9 Western blot analyses for Bcl-2 and cytochrome c proteins were carried out. The Bcl-2 and cytochrome c proteins expression were significantly (p < 0.05) different in groups 3 and 4, compared with that of groups 1 and 2 (Fig 4 , top, A). Using densitometry analyses, we found that the level of Bcl-2 in group 1 (1,467 ± 297 optical density units) and group 2 (1,297 ± 226 optical density units) were significantly higher than that of group 3 (575 ± 123 optical density units, p < 0.05 for both comparisons) and group 4 (483 ± 131 optical density units, p < 0.05 for both comparisons). However, the expression of cytochrome c in group 3 (14,165 ± 666 optical density units) and group 4 (16,460 ± 1,140 optical density units) was significantly higher than that of group 1 (9,749 ± 854 optical density units, p < 0.05 for both comparisons) and group 2 (10,103 ± 655 optical density units, p < 0.05 for both comparisons) [Fig 4 , bottom, B]. Expression of both proteins between groups 1 and 2 and groups 3 and 4 did not reach statistical significance.



View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 4.. Western blot analysis of Bcl-2 (top, A) and cytochrome c (bottom, B) in different groups. *p < 0.05 compared with group 1.

 

   Discussion
TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Our previous study4 suggested that continuous tepid blood cardioplegic solution could attenuate cardiomyocytic apoptosis after global cardiac ischemia/reperfusion injury during CPB. However, our previous article did not provide the possible molecular mechanism by which the different cardioplegic solutions affect the occurrence of apoptosis. In this study, we used ddPCR to identify cardioplegic solution-regulated genes in canine cardiomyocytes. This method provides an efficient and rapid alternative to subtractive hybridization approaches to identify differences in gene expression in cells exposed to different experimental conditions. Using ddPCR, we identified a number of candidate genes in canine cardiomyocytes that appear to be ischemia/reperfusion responsive. In this study, we demonstrated ischemia/reperfusion-mediated regulation of one such gene: mitochondrial NADH:ubiquinone oxidoreductase. Global cardiac ischemia/reperfusion induces NADH:ubiquinone oxidoreductase mRNA up-regulation, as confirmed by RT-PCR, which demonstrates that mitochondria gene expression is induced by ischemia/reperfusion injury. The up-regulation of the NADH:ubiquinone oxidoreductase gene might suggest the degree of mitochondrial damage during global ischemia/reperfusion using various cardioplegia cardioprotection, which subsequently induced cytochrome c release and cardiomyocytic apoptosis.

In this study, 60-min global cardiac arrest was established under CPB using various cardioplegic solutions to simulate clinical situations. Our previous study revealed that using the same protocol, cardiomyocytic apoptosis would be induced in groups 2, 3, and 4. However, the apoptotic nuclei number and expression of cleaved caspase-3 could be significantly attenuated in group 2. Because the rapid induction of various inflammatory cytokines in response to inflammatory and ischemia/reperfusion injury occurs by CPB and cardiac arrest, and a number of genes important in regulating inflammation and apoptosis are activated during the first few hours after CPB stimulation, we designed this study to identify possible responsive genes involved in cardiomyocytic apoptosis regulation.

RT-PCR demonstrated global cardiac arrest with cardioplegic solutions induction of nuclear-encoded portion of mitochondrial NADH:ubiquinone oxidoreductase in canine cardiac tissue, NDUFB2, which was a subunit of the hydrophilic portion of the complex. The speculated function of NDUFB2 contributes to the outer sections of the membranal part of complex I that communicated with mitochondrial matrix.18 The function of NADH:ubiquinone oxidoreductase is to oxidize the reduced NADH and generate electron flow.19 The energy generated by the electron flow is used to pump protons out of the matrix across the mitochondrial inner membrane. The resulting electrochemical gradient is used to convert inorganic phosphate and adenosine diphosphate to adenosine triphosphate (ATP). The maintenance of the electrochemical gradient of the mitochondria is essential for ATP production. Another important function of NADH:ubiquinone oxidoreductase is to regulate the reduction of oxidized glutathione to form glutathione, which could reduce hydrogen peroxide into water and diminish the production of reactive free radicals. The balance between oxidants and antioxidants from the steady state is essential for the regulation of biological processes such as apoptosis.

NADH-ubiquinone oxidoreductase is a complex system located in the inner mitochondrial membrane and has the ability to catalyze several different enzymatic reactions concerned in electron transport. It is known to be one of the first components of the respiratory chain to be damaged by ischemia.20 Rouslin and Millard21 reported that mitochondrial complex I is important site of cellular injury in myocardial ischemia. With the functional impairment of mitochondrial NADH-ubiquinone oxidoreductase during cardiac global ischemia/reperfusion under CPB, the mitochondrial capability of eliminating the excess cytoplasmic Ca2+ through an electrogenic process requiring oxygen were diminished22 and the glutamate/malate oxidative activities decrease,23 both of the above processes would induce cellular damage.

The endothelial responses and myocardial function are altered after exposure of cardiac and coronary tissue to cold crystalloid cardioplegia, which can be attenuated by warm blood cardioplegia.4 In this study, we revealed the possible mechanism that continuous tepid warm blood cardioplegia could elevate Bcl-2 expression, which in turn avoids leaking of cytochrome c through the mitochondrial membrane and diminished cardiomyocytic apoptosis. The differences of damage between groups 2, 3, and 4 might result from the mode of delivery. Continuous cardioplegia infusion provided persistent cardiomyocytic perfusion and eliminated the ischemia injury of cardiomyocytes, which resulted in the significant difference of the occurrence of cardiomyocytic apoptosis in group 2 from groups 3 and 4. It is possible that continuous cold blood cardioplegia administered the same way as in group 2 animal would provide a similar protective effect. The little difference of cardiomyocytic damage between groups 3 and 4 further supported the possibility.

Other reports have revealed that during ischemia/reperfusion, mitochondria play an important role in apoptosis via the following possible mechanisms: (1) they are an important source of hydrogen peroxide,24 (2) they cause a decline in respiration that could not cope with the overproduction of reactive oxygen species,25 and (3) they cause damage to proteins of electron transport chain complexes with further inhibition of ATP production and formation of protein-protein cross-links, which may increase electron leaks.26 These observations suggest that mitochondria have an important role in the cardiomyocytic apoptosis after global ischemia/reperfusion injury during CPB.

In summary, studies8 10 21 suggest that direct effects of ischemia/reperfusion on cardiomyocytic apoptosis may contribute to the effects of ischemia/reperfusion insult on cardiomyocytic gene expression and the damage of mitochondria. Our results demonstrate that continuous tepid blood cardioplegic solution could diminish the ischemia/reperfusion insult, preserve the mitochondrial enzymes, and reduce the up-regulation of NADH:ubiquinone oxidoreductase gene expression. We speculated that the possible mechanism of tepid continuous blood cardioplegic solution maintains the function of mitochondrial enzymes, elevates the expression of Bcl-2, and blocks the leakage of cytochrome c from the mitochondria, thus attenuating cardiomyocytic apoptosis. In this study we demonstrated the feasibility of ddPCR for studying gene expression in canine cardiomyocytes. The induction of complex I gene expression by various cardioplegic solutions reported here represents the first identification of a gene in the mitochondrial respiratory chain and thus represents a first step in elucidating the molecular mechanisms by which mitochondria affect the destiny of cardiomyocytes after global ischemia/reperfusion injury during CPB. This study also shows for the first time that cardioplegic solutions-mediated global cardiac arrest during ischemia/reperfusion under CPB can modify gene expression of a specific mitochondrial gene in canine cardiomyocytes.


   Footnotes
 
Abbreviations: ATP = adenosine triphosphate; bp = base-pair; cDNA = complementary DNA; CPB =cardiopulmonary bypass; ddPCR = differential-display polymerase chain reaction; GAPDH = glyceraldehyde phosphate dehydrogenase; mRNA = messenger RNA; NADH = nicotinamide adenine dinucleotide; PCR = polymerase chain reaction; RT = reverse transcription; RT-PCR = reverse transcription polymerase chain reaction

Received for publication January 30, 2003. Accepted for publication June 5, 2003.


   References
TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Hill, GE, Whitten, CW, Landers, DF (1997) The influence of cardiopulmonary bypass on cytokines and cell-cell communication. J Cardiothorac Vasc Anesth 11,367-375[CrossRef][ISI][Medline]
  2. Wernovsky, G, Wypij, D, Jonas, RA, et al Postoperative course and hemodynamic profile after the arterial switch operation in neonates and infants: a comparison of low-flow cardiopulmonary bypass and circulatory arrest. Circulation 1995;92,2226-2235[Abstract/Free Full Text]
  3. Schmitt, JP, Schroder, J, Schunkert, H, et al Role of apoptosis in myocardial stunning after open heart surgery. Ann Thorac Surg 2002;73,1229-1235[Abstract/Free Full Text]
  4. Yeh, CH, Wang, YC, Wu, YC, et al Continuous tepid blood cardioplegia can preserve coronary endothelium and ameliorate the occurrence of cardiomyocytic apoptosis. Chest 2003;123,1647-1654[Abstract/Free Full Text]
  5. Kilbridge, PM, Mayer, JE, Newburger, JW, et al Induction of intercellular adhesion molecule-1 and E-selectin mRNA in heart and skeletal muscle of pediatric patients undergoing cardiopulmonary bypass. J Thorac Cardiovasc Surg 1994;107,1183-1192[Abstract/Free Full Text]
  6. Burns, SA, DeGuzman, BJ, Newburger, JW, et al P-selectin expression in myocardium of children undergoing cardiopulmonary bypass. J Thorac Cardiovasc Surg 1995;110(4 pt 1),924-933
  7. Burns, SA, Newburger, JW, Xiao, M, et al Induction of interleukin-8 messenger RNA in heart and skeletal muscle during pediatric cardiopulmonary bypass. Circulation 1995;92(suppl 9),II315-II321
  8. Jassem, W, Fuggle, SV, Rela, M, et al The role of mitochondria in ischemia/reperfusion injury. Transplantation 2002;73,493-499[CrossRef][ISI][Medline]
  9. Yang, J, Liu, X, Bhalla, K, et al Prevention of apoptosis by Bcl-2: release of cytochrome c from mitochondria blocked. Science 1997;275,1129-1132[Abstract/Free Full Text]
  10. Marin-Garcia, J, Goldenthal, MJ, Moe, GW Mitochondrial pathology in cardiac failure. Cardiovasc Res 2001;49,17-26[Free Full Text]
  11. Suleiman, MS, Halestrap, AP, Griffiths, EJ Mitochondria: a target for myocardial protection. Pharmacol Ther 2001;89,29-46[CrossRef][ISI][Medline]
  12. Sawyer, DB, Colucci, WS Mitochondrial oxidative stress in heart failure: "oxygen wastage" revisited. Circ Res 2000;86,119-120[Free Full Text]
  13. Chomczynski, P, Sacchi, N Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162,156-159[ISI][Medline]
  14. Ellis, RE, Yuan, J, Horvitz, R Mechanisms and functions of cell death. Annu Rev Cell Biol 1991;7,663-698[CrossRef][ISI][Medline]
  15. Cheng, W, Kajstura, J, Nitahara, JA, et al Programmed myocyte cell death affects the viable myocardium after infarction in rats. Exp Cell Res 1996;226,316-327[CrossRef][ISI][Medline]
  16. Kajstura, J, Mansukhani, M, Cheng, W, et al Programmed cell death and expression of the protooncogene bcl-2 in myocytes during postnatal maturation of the heart. Exp Cell Res 1995;219,110-121[CrossRef][ISI][Medline]
  17. Olivetti, G, Abbi, R, Quaini, F, et al Apoptosis in the failing human heart. N Engl J Med 1997;336,1131-1141[Abstract/Free Full Text]
  18. Loeffen, JL, Triepels, RH, van den Heuvel, LP, et al cDNA of eight nuclear encoded subunits of NADH: ubiquinone oxidoreductase: human complex I cDNA characterization completed. Biochem Biophys Res Commun 1998;253,415-422[CrossRef][ISI][Medline]
  19. Jassem, W, Fuggle, SV, Rela, M, et al The role of mitochondria in ischemia/reperfusion injury. Transplantation 2002;73,493-499[CrossRef][ISI][Medline]
  20. van Jaarsveld, H, Potgieter, GM, Lochner, A Changes in NADH-ubiquinone reductase (complex I) with autolysis in the rat heart as experimental model. Enzyme 1986;35,206-214[Medline]
  21. Rouslin, W, Millard, RW Mitochondrial inner membrane enzyme defects in porcine myocardial ischemia. Am J Physiol 1981;240,H308-H313[ISI][Medline]
  22. Turrens, JF, Beconi, M, Barilla, J, et al Mitochondrial generation of oxygen radicals during reoxygenation of ischemic tissues. Free Radic Res Commun 1991;12–13,681-689
  23. Veitch, K, Hombroeckx, A, Caucheteux, D, et al Globalischaemia induces a biphasic response of the mitochondrial respiratory chain. Anoxic pre-perfusion protects against isch-aemic damage. Biochem J 1992;281(Pt 3),709-715[Medline]
  24. Gonzalez-Flecha, B, Curtin, JC, Boveris, A Time course and mechanism of oxidative stress and tissue damage in rat liver subject to in vivo ischemia-reperfusion. J Clin Invest 1993;91,456-464[ISI][Medline]
  25. Schild, L, Reinheckel, T, Winswedel, I, et al Short-term energy production in isolated rat mitochondria by hypoxia/reoxygenation: involvement of oxidative protein modification. Biochem J 1997;328,205-210
  26. Zhang, Y, Marcillat, O, Giulivi, C, et al The oxidative inactivation of mitochondrial electron transport chain components and ATPase. J Biol Chem 1990;265,16330-16336[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Article Archive
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yeh, C.-H.
Right arrow Articles by Lin, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yeh, C.-H.
Right arrow Articles by Lin, P. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS