Chest ACCP Member Benefits
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Guest Access | Sign In via User Name/Password
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Article Archive
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tomic, R.
Right arrow Articles by Roman, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tomic, R.
Right arrow Articles by Roman, J.
(Chest. 2005;127:257-265.)
© 2005 American College of Chest Physicians

Anti-Tissue Remodeling Effects of Corticosteroids*

Fluticasone Propionate Inhibits Fibronectin Expression in Fibroblasts

Rade Tomic, MD; Charles C. Lassiter, MD; Jeffrey D. Ritzenthaler, MA; Hilda N. Rivera, BA and Jesse Roman, MD

* From the Department of Medicine (Drs. Tomic, Lassiter, and Roman, and Mr. Ritzenthaler), Division of Pulmonary, Allergy and Critical Care Medicine; and Atlanta VA Medical Center and Emory University School of Medicine (Ms. Rivera), Atlanta, GA.

Correspondence to: Jesse Roman, MD, Emory University School of Medicine, Whitehead Biomedical Research Building, 615 Michael St, Suite 205-M, Atlanta, GA 30322; e-mail: jroman{at}emory.edu


   Abstract
TOP
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Objectives: Tissue remodeling often accompanies diseases such as COPD that are caused by or aggravated by tobacco exposure. Inhaled or systemic corticosteroids are frequently used for the treatment of these illnesses, and their beneficial effects are often ascribed to their anti-inflammatory properties. However, their role in tissue remodeling remains unclear. This study was designed to evaluate the role of corticosteroids in matrix expression in vitro.

Design: We investigated the effects of the corticosteroid fluticasone propionate (FP) on the production of fibronectin by fibroblasts before and after stimulation by nicotine, a plant alkaloid found in tobacco. Fibronectin is an extracellular matrix glycoprotein found elevated in the alveolar lining fluid and airway walls of subjects with obstructive lung disease, and is considered a marker of tissue remodeling after injury.

Results: FP, 1 µmol/L, inhibited the expression of fibronectin messenger RNA and protein in unstimulated NIH-3T3 cells and primary lung fibroblasts, as well as in fibroblasts stimulated with nicotine. The inhibitory effect of FP occurred at the level of gene transcription as demonstrated in lung fibroblasts expressing a construct containing the human fibronectin promoter connected to a luciferase reporter gene, but posttranscriptional effects also appeared involved. Electrophoresis mobility gel shift assays revealed that FP inhibited phosphorylation and DNA binding by the cyclic adenosine monophosphate response element binding protein, a transcription factor required for constitutive and nicotine-induced fibronectin expression.

Conclusions: Together, these data suggest that FP could diminish lung tissue remodeling by inhibiting the production of fibronectin in lung fibroblasts.

Key Words: cyclic adenosine monophosphate response element binding protein • fibroblasts • fibronectin • gene transcription • matrix • nicotine • remodeling


   Introduction
TOP
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Tobacco is an important etiologic factor in the development of COPD, and is considered an aggravating factor in a number of interstitial lung diseases.1 In general, these pulmonary disorders are characterized by inflammation and the activation of tissue remodeling that result in structural alterations such as airway wall thickening and the destruction of alveolar septae.2 Corticosteroids are commonly used in the treatment of these disorders, and their beneficial effects are often ascribed to their anti-inflammatory properties.3 More recently, attention has been given to the potential effects of corticosteroids on tissue remodeling. For example, inhalation of the corticosteroid fluticasone propionate (FP) was found to partially inhibit airway wall thickening and matrix deposition in a rat model of allergen-induced airway remodeling,4 and limited the progression of structural airway changes in this model.5 These studies suggest that corticosteroids might ameliorate progressive tissue remodeling in diseases characterized by airflow obstruction, but the mechanisms responsible for this effect remain unelucidated. We speculate that corticosteroids might inhibit lung tissue remodeling by directly modulating the expression of extracellular matrix genes in lung fibroblasts.

In an attempt to elucidate the effects of corticosteroids on extracellular matrix gene expression, we studied the expression of fibronectin in fibroblasts treated with FP. Fibronectin is an extracellular matrix glycoprotein that is highly expressed in acute and chronic forms of lung injury including COPD, asthma, and many interstitial lung diseases. Villiger et al6 demonstrated an increase in the production of fibronectin in alveolar macrophages obtained from smokers when compared to nonsmokers. Alveolar macrophages from patients with chronic bronchitis spontaneously released greater amounts of fibronectin than those from asthmatic patients and control subjects.7 The levels of fibronectin have been correlated with a decrease in pulmonary function in smokers with COPD.8 In asthma, airway wall remodeling is not only associated with increased deposition of extracellular matrices, but also with alterations in the composition of the airway wall connective tissue with increased deposition of fibronectin.91011 The aforementioned studies have implicated excessive production of fibronectin as a marker of activation of tissue remodeling and a potential mechanism for promoting fibroproliferation in tobacco-related lung disease.

Herein, we present evidence that suggests that FP can modulate lung tissue remodeling by inhibiting the expression of the fibronectin gene in fibroblasts at baseline and after treatment with nicotine. This effect is related to the ability of FP to inhibit DNA binding by cyclic adenosine monophosphate response element binding protein (CREB), a transcription factor necessary for stimulation of fibronectin gene transcription.


   Materials and Methods
TOP
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents
Nicotine, antifibronectin (F-3648) antibody, goat antirabbit horseradish peroxidase (A-9169) antibody, and albuterol were purchased from Sigma Chemicals (St. Louis, MO). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody was purchased from Abcam, (Cambridge, MA). CREB and phosphorylated CREB (Ser133) antibodies were purchased from Cell Signaling Technologies (Beverly, MA). FP was obtained from Glaxo Group Research (Greenford, Middlesex, UK). Real-time polymerase chain reaction (PCR) primers and probes were synthesized by Epoch Biosciences (Bothell, WA).

Cell Culture and Treatment
Murine NIH-3T3 fibroblasts (CRL No. 1658; American Type Culture Collection; Manassas, VA) were cultured in Dulbecco modified Eagle medium (DMEM) with 4.5 g/L of glucose supplemented with 10% heat inactivated fetal bovine serum (FBS), 1% antibiotic-antimycotic solution (100 U/mL penicillin G sodium, 100 U/mL streptomycin, 0.25 µg/mL amphotericin B), and incubated in a humidified 5% CO2 incubator at 37°C. The cells were harvested by trypsinization with 2.5 x trypsin (Sigma Chemicals), washed twice with phosphate buffered saline solution (PBS) [137 mmol/L NaCl, 2.7 mmol/L KCl, 4.3 mmol/L Na2HPO4, 1.47 mmol/L KH2PO4, pH to 7.4], counted, and plated at 1.5 x 105 cells per well into six-well tissue culture dishes.

Primary lung fibroblasts were harvested from transgenic mice expressing the human fibronectin promoter connected to a luciferase reporter gene, pFN(1.2kb)LUC.12 The characterization of these animals indicates that the expression in the lung of the transfected gene is similar to that of the endogenous fibronectin gene (unpublished observations). Primary lung fibroblasts were obtained from mouse lungs by discarding the outer 3 mm of lung periphery and cutting the remaining lung parenchymal tissue into 1-mm sections. Tissue sections were washed twice in sterile PBS, resuspended in DMEM with 4.5 g/L glucose, 10% FBS, 1% antibiotic-antimycotic solution (100 U/mL penicillin G sodium, 100 U/mL streptomycin, 0.25 µg/mL amphotericin B), transferred to a tissue culture dish, and incubated in a humidified 5% CO2 incubator at 37°C for 1 to 3 weeks to allow fibroblasts to migrate out of tissue sections. Primary lung fibroblasts were between three passages and five passages when used in experiments.

Experimental treatments include nicotine (50 µg/mL), fluticasone (0.1 to 50 µmol/L), or albuterol (10 µmol/L), or the combination of these agents. The doses of experimental agents were chosen based on previous experiments. Cell viability was determined by Trypan blue exclusion. No alterations in cell viability were noted under the conditions and treatments described. Also, gross evaluation of cell attachment and appearance by light microscopy did not reveal alterations with the treatments described.

Western Blotting for Fibronectin
Fibroblasts (1.5 x 105/mL) were pretreated with or without FP for 1 h prior to incubation in the presence or absence of nicotine for 48 h, washed with ice-cold PBS, and lysed in 1 mL of homogenization buffer (50 mmol/L NaCl, 50 mmol/L NaF, 50 mmol/L NaP2O7-10 H2O, 5 mmol/L ethylenediamine tetra-acetic acid [EDTA], 5 mM ethyleneglycol tetra-acetic acid, 2 mmol/L Na3 sodium [ortho] vanadate, 0.5 mmol/L phenylmethylsulfonyl fluoride, 0.01% Triton X-100, 10 µg/mL leupeptin, 10 mmol/L hydroxylethyl piperazine-ethanesulfonic acid, pH 7.4). Pretreatment with FP for 1 h prior to nicotine exposure was chosen because preliminary experiments revealed that concurrent treatment with FP showed inefficient inhibition. The resulting homogenate was centrifuged at 14,000 revolutions per minute for 5 min at 4°C. Protein concentration was determined by the Bradford method.13 The protein (100 µg) was mixed with an equal volume of 2 x sample buffer (125 mmol/L Tris HCl, pH 6.8, 4% sodium dodecysulfate [SDS], 20% glycerol, 5 to 10% ß-mercaptoethanol, 0.004% bromophenol blue), boiled for 5 min, loaded onto a 5% SDS-polyacrylamide gel (10% SDS-polyacrylamide gel for CREB and phosphorylated CREB) with a 3.5% stacking gel, and electrophoresed for 2 h at 60 mA. The separated proteins were transferred onto nitrocellulose using a BioRad Trans Blot semidry transfer apparatus for 2 h at 1.0 mA/cm2, blocked with blotto (1 x Tris-buffered saline solution [10 mmol/L Tris-HCl, pH 8.0, 150 mmol/L NaCl], 5% nonfat dry milk, 0.05% Tween-20) for 1 h at room temperature, and washed twice for 5 min with wash buffer (1 x Tris-buffered saline solution, 0.05% Tween-20). Blots were incubated with a polyclonal antibody raised against human fibronectin (1:1000 dilution), human CREB (1:1,000 dilution), or human phosphorylated CREB (Ser133) [1:1,000 dilution] for 24 h at 4°C, washed three times for 5 min with wash buffer, and incubated with a secondary rabbit antibody raised against goat IgG conjugated to horseradish peroxidase (1:15,000 dilution) for 1 h at room temperature. Identically loaded blots used for loading controls were incubated with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) [1:2000 dilution] primary antibody. The blots were washed four times in wash buffer, transferred to freshly made ECL solution (Amersham; Arlington, IL) for 1 min, and exposed to radiograph film. Protein bands were quantified by densitometric scanning using a GS-800 calibrated laser densitometer (Bio-Rad; Hercules, CA). Western blots were repeated at least four times using samples from four separate experiments.

Detection of mRNAs by Real-time PCR
Total cellular RNA was extracted from NIH-3T3 fibroblasts (1.5 x 105/mL) pretreated with FP (1 µmol/L) for 1 h prior to nicotine (50 µg/mL) treatment for 24 h using a published method1415 and modified as we previously described.16 The reverse transcription reactions of the extracted RNA were performed by combining the following reagents in a PCR reaction tube: 0.625 µmol/L deoxynucleoside triphosphates, 16 nm random hexamer oligonucleotides (Roche Diagnostics; Indianapolis, IN), 5 µL first-strand buffer (50 mmol/L Tris-HCl, pH 8.3, 75 mmol/L KCl, 3 mmol/L MgCl2) [Invitrogen; Carlsbad, CA], 20 mmol/L dithiothreitol, 200 U reverse transcriptase enzyme, 0.5 µL ribonuclease inhibitor (Rnasin; Promega; Madison, WI), and 1 µg extracted RNA in a total volume of 25 µL. Samples were heated to 70°C for 5 min, chilled on ice for 5 min, centrifuged briefly, incubated at 42°C for 1 h followed by a 10-min incubation at 90°C, and chilled on ice for 5 min.

Real-time PCR reactions were set up by adding the following reagents to Smart Cycler Reaction Tubes (Cepheid; Sunnyvale, CA): 5 mmol/L MgCl2, 0.2 µmol/L forward primer, 0.2 µmol/L reverse primer, 0.2 µmol/L probe (3' FAM Amidite), 1x platinum quantitative PCR (SuperMix-UDG; Invitrogen), template complementary DNA (500 ng total). Forward, reverse, and probe primers for human fibronectin messenger RNA (mRNA) were 5' GGGAACGGAAAAGGAGAA, 5' AGCAAATGGC ACCGAGATA, and 5' AGGAGAACAGTGGCAGA, respectively. Forward, reverse, and probe primers for human ß-actin mRNA were 5' GCGTGATGGTGGGCAT, 5' ATGGGGT ACTTCAGGGT, and 5' GATTCCTATGTGGGCGA, respectively. Negative controls consisted of distilled H2O in place of template complementary DNA, RNA without reverse transcriptase-PCR products, and standardization was made to the housekeeping gene ß-actin. Samples were briefly centrifuged and processed using the following cycle program using the Smart Cycler (Cepheid): hold at 95°C for 120 s followed by 40 cycles at temperatures of 95°C for 15 s, 60°C (56°C for ß-actin) for 30 s, and 72°C for 30 s. Results of the log-linear phase of the growth curve were analyzed by use of the mathematical equation of the second derivative, and relative quantification was performed using the 2-{Delta}{Delta}CT method.17 All products were verified by agarose gel electrophoresis to ensure that the predicted mRNA species was being examined.

Examination of Fibronectin Gene Transcription
To evaluate for fibronectin gene transcription, the pFN(1.2kb)LUC promoter construct was introduced into murine NIH-3T3 fibroblasts via electroporation to create stable transfectants as previously described.12 In addition, primary lung fibroblasts harvested from transgenic mice expressing pFN(1.2kb)LUC were tested. pFN(1.2kb)LUC contains approximately 1,200 base-pairs (bp) of the 5' flanking region of the human fibronectin gene isolated from the human fibrosarcoma cell line HT1080.18 This construct also contains several previously identified regulatory elements such as three cyclic adenosine monophosphate (cAMP) response elements located at – 415 bp, – 270 bp, and – 170 bp, and a signal protein-1 site at – 102 bp from the transcription start site.

The NIH-3T3 fibroblasts were harvested by trypsinization with 2.5 x trypsin and 5.3 mmol/L EDTA (Sigma Chemicals), washed with PBS, counted, and plated at 1.5 x 105/mL in 12-well tissue culture dishes in 10% FBS. Fibroblasts were pretreated with or without FP or albuterol for 1 h prior to incubation with or without nicotine for 16 h. An incubation time of 16 h was chosen based on preliminary time-course experiments that showed maximal nicotine-induced fibronectin gene transcription at that time (not shown). Afterwards, the cells were tested for luciferase activity. For this, the cells were harvested by cell scraper, washed with PBS, resuspended in 100 µL of cell lysis buffer (Promega), sonicated, and a 10-µL aliquot was tested by adding 50 µL of luciferase assay reagent (Promega). Light intensity was measured using a Luminoskan Ascent plate luminometer (Labsystems; Helsinki, Finland). Results were recorded as normalized luciferase units and adjusted for total protein content that was measured using the Bradford method.13

Electrophoretic Mobility Shift Assay
NIH-3T3 fibroblasts (3 x 106/mL) were seeded onto 150-mm2 tissue culture flasks and in DMEM with 10% heat inactivated FBS, and incubated the presence or absence of FP or albuterol for 1 h prior to treatment with or without nicotine in for 16 h in a humidified 5% CO2 incubator at 37°C. Cells were washed with ice-cold PBS, and nuclear binding proteins were extracted by a published method.19 Protein concentration was determined by the Bradford method using BioRad protein assay reagent. Double-stranded cAMP-responsive element binding protein consensus oligonucleotide (5'AGAGATTGCCTGACGTCAGAG AGCTAG) was labeled with 32P gamma adenosine triphosphate using T4 polynucleotide kinase enzyme. Nuclear protein (5 µg) was incubated with 32P-labeled CREB for 30 min at room temperature as described previously.20 DNA-protein complexes were separated on 6% native polyacrylamide gel (20:1 acrylamide/bis ratio) in low-ionic-strength buffer (22.25 mmol/L Tris borate, 22.25 mmol/L boric acid, 500 mmol/L EDTA) for 2 to 3 h at 4°C at 10 V/cm. Gels were fixed in a 10% acetic acid/10% methanol solution for 10 min, dried under vacuum, and exposed to radiograph film. All samples were evaluated and cleared for presence of lipopolysaccharide.21

Statistical Analysis
Reverse transcriptase-PCR data were analyzed using the 2-{Delta}{Delta}CT method.17 Gene transcription data were analyzed by Student t test method. Each case data from individual groups were compared to the control group. All experiments were repeated between four times and eight times.


   Results
TOP
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
FP Inhibits Fibronectin Expression in Fibroblasts
Like other fibroblasts, cultured NIH-3T3 fibroblasts produce fibronectin in a constitutive fashion, and we have previously demonstrated that nicotine greatly enhances fibronectin expression in these cells.22 To examine the effects of FP on fibronectin protein expression, NIH-3T3 fibroblasts were pretreated in the presence or absence of FP for 1 h, cultured with or without nicotine (50 µg/mL) for 48 h, followed by harvesting and processing for western blotting. As demonstrated in Figure 1 , left, A, untreated fibroblasts produced fibronectin protein, and this was greatly enhanced by treatment with nicotine. FP pretreatment inhibited the production of fibronectin protein in both untreated and nicotine-stimulated fibroblasts. In addition, nicotine also stimulated an increase in fibronectin mRNA of > 2.5-fold (p < 0.03) as compared to untreated control cells as demonstrated in Figure 1, right, B. Preincubation of fibroblasts for 1 h with FP was associated with a significant reduction (p < 0.04) in fibronectin mRNA accumulation in nicotine-treated fibroblasts as determined by real-time PCR.



View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 1. FP inhibits fibronectin protein expression. Left, A: NIH-3T3 fibroblasts were pretreated with or without FP (1 µmol/L) for 1 h prior to incubation in the presence or absence of nicotine (50 µg/mL) and submitted to Western blotting. This experiment was repeated four times with similar results. A representative blot is depicted. Note that fibronectin protein expression is increased in the presence of nicotine. However, in the presence of FP, constitutive and nicotine-induced fibronectin protein expression are diminished. Right, B: FP inhibits fibronectin mRNA expression. Total cellular RNA was extracted from NIH-3T3 fibroblasts pretreated with FP (1 µmol/L) for 1 h prior to nicotine (50 µg/mL) treatment for 24 h, and the reverse transcription reactions were performed. Note that fibronectin mRNA expression is significantly increased (n = 4, p < 0.04) in the presence of nicotine. However, in the presence of FP, constitutive and nicotine-induced fibronectin mRNA expression are diminished (n = 4).

 
FP Inhibits Fibronectin Gene Transcription in Fibroblasts
The observations described above suggested that FP might exert its effect by inhibiting fibronectin gene transcription. To test this, NIH-3T3 fibroblasts were stably transfected with pFN(1.2kb)LUC, a DNA construct containing the human fibronectin promoter fused to a luciferase reporter gene. As expected, the transfected cells showed constitutive fibronectin gene transcription as determined by measuring luciferase activity (Fig 2 , top, A). The transcription of the fibronectin gene was enhanced by treatment with nicotine alone (p < 0.001). Of note, the exposure of fibroblasts to FP inhibited the transcription of the fibronectin gene at baseline and after nicotine stimulation (p < 0.001). The effect of FP pretreatment on nicotine-induced fibronectin gene transcription was exerted in a dose-dependent manner with maximum activity between 1 and 5 µmol/L FP (Fig 2, top, A, insert). The same effect was observed in primary mouse lung fibroblasts containing pFN(1.2 kb)LUC, where FP pretreatment significantly (p < 0.001) inhibited transcription of the fibronectin gene after nicotine stimulation (Fig 2, bottom, B).



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 2. FP inhibits fibronectin gene transcription. Top, A: NIH-3T3 fibroblasts transfected with the pFN(1.2kb)LUC promoter construct were pretreated with or without FP (1 µmol/L) for 1 h prior to treatment with or without nicotine (50 µg/mL) for 16 h. Note that fibronectin gene transcription is increased in the presence of nicotine. However, in the presence of fluticasone, constitutive and nicotine-induced fibronectin gene transcription is diminished. Results are expressed as mean values ± SD (n = 8). *p = 0.001, nicotine vs control. Top, A, insert: dose-dependant effect of FP. NIH-3T3 cells permanently transfected with pFN(1.2kb)LUC promoter construct were pretreated with or without FP (0.1 to 50 µmol/L) for 1 h prior to treatment with or without nicotine (50 µg/mL) for 16 h. Note that FP caused a dose-dependent decrease in nicotine-induced fibronectin gene transcription. Results are expressed as mean values ± SD (n = 8). Bottom, B: primary lung fibroblasts were harvested from transgenic mice expressing the human fibronectin promoter connected to a luciferase reporter gene. Fibroblasts were pretreated with or without FP (1 µmol/L) for 1 h prior to treatment in the presence or absence of nicotine (50 µg/mL) for 16 h. Note that nicotine induced the transcription of the fibronectin gene as compared to untreated control cells; however, in the presence of fluticasone, transcription is diminished. Results are expressed as mean values ± SD.

 
We and others12 have shown that fibronectin gene transcription is dependent on phosphorylation and DNA binding by the transcription factor CREB. Consequently, we postulated that FP might affect fibronectin expression by inhibiting CREB. Consistent with this idea, we found that nicotine-treated fibroblasts show increased CREB phosphorylation when compared to untreated fibroblasts. FP pretreatment diminished phosphorylated CREB after nicotine stimulation, whereas the amount of total CREB protein remained relatively unchanged (Fig 3 , top, A).



View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
  		Figure 3. FP inhibits CREB phosphorylation and DNA binding. Top, A: NIH-3T3 fibroblasts were pretreated with or without FP (1 µmol/L) for 1 h prior to incubation in the presence or absence of nicotine (50 µg/mL) for 24 h. Note that phosphorylated CREB (p-CREB) [Ser 133] protein expression is increased in presence of nicotine. However, in the presence of FP, nicotine-induced fibronectin protein expression is diminished while the total amount of CREB protein remains unchanged. Bottom, B: FP inhibits CREB-DNA binding. NIH-3T3 fibroblasts (3 x 106/mL) were incubated in the presence or absence of FP (1 µmol/L) or albuterol (10 µmol/L) for 1 h prior to treatment with or without nicotine (50 µg/mL) for 16 h. Note that nicotine-treated cells show enhanced CREB-DNA binding as compared to untreated control cells. Albuterol also stimulated CREB-DNA binding; however, FP was able to abrogate CREB-DNA binding in cells exposed to nicotine.

 
To determine if FP also inhibited DNA binding by CREB, electrophoresis mobility gel shift assays were conducted with nuclear protein extracted from NIH-3T3 fibroblasts pretreated with or without FP for 1 h prior to exposure with or without nicotine (50 µg/mL). As demonstrated in Figure 3, bottom, B, untreated fibroblasts showed little to no CREB-DNA binding, whereas nicotine-treated cells showed increased binding. FP pretreatment inhibited DNA binding after nicotine treatment. Albuterol was used as control and was found to increase CREB-DNA binding in fibroblasts.


   Discussion
TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Corticosteroids are commonly used in the management of lung diseases induced or exacerbated by environmental tobacco smoke and characterized by airflow limitation such as asthma and COPD.2324 The beneficial effects of corticosteroids in this setting are often ascribed to their powerful anti-inflammatory activity.2526 However, studies4527 suggest that corticosteroids might affect tissue remodeling as well. Vanacker et al45 showed that FP, the corticosteroid used here, inhibited the progression of allergen-induced structural changes in the airways of rats. These effects were associated with inhibition of epithelial cell proliferation, goblet cell hyperplasia, and airway wall thickening. Blyth et al28 showed significant resolution of established subepithelial fibrosis in a murine model of atopia. Moreover, Chetta et al29 showed that fluticasone can reduce the vascular component of airway remodeling. In humans, Hoshino et al30 showed that inhaled corticosteroids can reduce the lamina reticularis of the basement membrane by modulating insulin-like growth factor-I expression in bronchial asthma, and Olivieri et al31 showed that fluticasone might control the intensity of airway remodeling. Together, these studies suggest that corticosteroids can diminish lung tissue remodeling, thereby ameliorating the progression of disease. However, the exact mechanisms by which corticosteroids exert their anti-tissue remodeling effects remain to be fully elucidated.

We hypothesize that corticosteroids modulate lung tissue remodeling by affecting intracellular signaling pathways that control the expression of extracellular matrix genes. The data presented here suggest that this hypothesis is correct. We report that nicotine stimulates the production of fibronectin in transformed and primary lung fibroblasts. The induction of fibronectin was due to increased transcription of the fibronectin gene followed by accumulation of fibronectin mRNA and secretion of its protein. Consistent with our hypothesis, we found that FP inhibited the production of fibronectin in lung fibroblasts by blocking the transcription of the fibronectin gene, thereby decreasing fibronectin protein production. This inhibitory effect was related to blockade of CREB phosphorylation, a transcription factor known to be important in regulation of fibronectin gene transcription. In turn, inhibition of CREB phosphorylation was associated with decreased CREB binding to DNA leading to diminished gene transcription.

Although these studies were carried out in vitro, they have important clinical implications that should be further investigated. First, they suggest that the detrimental effects of tobacco in the lung might be partly related to nicotine, an alkaloid present in tobacco. Therefore, tobacco may affect the lung even when used in smokeless form. Second, they unveil another mechanism by which tobacco can affect the lung; namely, through induction of fibroblast-driven matrix expression and deposition. In view of the fact that matrix molecules have many effects on inflammation and vice versa, it is not difficult to envision how nicotine-induced tissue remodeling may promote inflammation thereby accelerating disease progression. Third, they reveal a novel mechanism by which corticosteroids might ameliorate lung tissue remodeling in the setting of tobacco abuse.

The effects of corticosteroids on fibronectin expression were found to be dose dependent. This is not unexpected, but it is considered an important observation in view of the work of Vanacker and colleagues,27 who showed that, despite inhibition of the initial increase in airway hyperresponsiveness with mild-to-moderate doses of corticosteroids, tissue remodeling progressed. In the same study, Vanacker et al found that higher doses of corticosteroids were definitely needed to inhibit tissue remodeling, which, in turn, had important consequences on clinical symptoms.2732 Thus, corticosteroid doses higher than those needed to control inflammation appear to be required to significantly impact tissue remodeling. This suggests that, in the clinical arena, it might be beneficial to determine optimal doses of corticosteroids based on markers of tissue remodeling rather than based exclusively on markers of inflammation. Of course, much work is needed to identify sensitive and easily accessible markers of lung tissue remodeling.

The recognition that corticosteroids may impact fibronectin expression directly is important because the reduction in fibronectin noted in airway walls after FP treatment could be ascribed to inhibition of plasma leakage.33 Since fibronectin is abundant in plasma, inhibition of plasma leakage could explain the reduction in fibronectin tissue deposition. However, our data suggest that corticosteroids can also inhibit fibronectin expression in lung fibroblasts; therefore, we believe that this is likely to be a more important mechanism in the setting of tobacco-related disease.

This study also suggests that corticosteroids affect matrix gene expression by specifically inhibiting the activities of specific transcription factors. The effects of corticosteroids on other transcription factors (eg, sequestration of nuclear factor-{kappa}B and activator protein [AP]-1) have been documented before, and this mechanism has been used to explain the inhibitory effects of corticosteroids on genes encoding for cell adhesion (eg, vascular cell adhesion molecule) and proinflammatory molecules (eg, cytokines).34353637 However, these transcription factors may also affect genes involved in connective tissue remodeling. For example, activator protein-1 is considered an important modulator of the expression of matrix metalloproteinase (MMP)-9 and other MMPs that have been implicated in the pathogenesis of asthma and COPD.3839 Herein, we show that corticosteroids affect yet another transcription factor, CREB. Following phosphorylation, CREB binds to the cAMP response element consensus sequence, which is present in the promoter of a number of genes including that of fibronectin. Therefore, it is likely that more than a few remodeling genes are affected by corticosteroids through this mechanism, and this may explain the work by Hoshino et al,38 who showed that in humans, corticosteroids reduced subepithelial collagen deposition, down-regulated the expression of MMP-9, and up-regulated tissue inhibitor of MMP molecules.

This study also suggests that drugs commonly used for the management of tobacco-related diseases might affect tissue remodeling. Although corticosteroids are likely to be beneficial in this setting, other drugs may not. In this regard, we showed that a ß2-agonist, albuterol, did not inhibit CREB-DNA binding; instead, it stimulated it. ß2-agonists are potent drugs used to induce bronchodilatation in the setting of obstructive lung disease. However, we do not know what effects the long-term use of these drugs have on lung tissue remodeling. Wang and others40 found that short-acting ß2-agonists increased fibronectin deposition in their model of long-term antigen exposure in guinea pigs, and that this effect was ameliorated by fluticasone.41 This is not surprising when viewed together with data indicating that these agents stimulate the phosphorylation of CREB.42 This suggests that some of these drugs may have unforeseen effects, and that their functions may be influenced by so-called "cross-talk" between transcription factors such as AP-1, nuclear factor-{kappa}B, and CREB. The interactions of these drugs with one another, particularly as they relate to tissue remodeling, should also be investigated. Dong et al43 showed that ß2-agonists increase the number and function of glucocorticoid receptors though a number of mechanisms. Therefore, the use of these drugs in combinations might allow for recipients to benefit from these drugs while diminishing their negative effects. Of course, this speculation needs to be tested in humans.

Finally, it should be highlighted that the inhibitory effects of fluticasone on mRNA expression in the absence of dramatic effects on promoter activity or CREB phosphorylation suggest additional effects at the posttranscriptional level. This is not surprising in view of data by others demonstrating that glucocorticoids can affect the posttranscriptional modification of several proteins including that of keratinocyte adhesion molecules,44 brain manganese-superoxide dismutase,45 and myelin basic protein.46 Thus, our data suggest that fluticasone might also be exerting posttranscriptional effects that regulate fibronectin protein production.

In summary, we showed that nicotine induced the expression of fibronectin by stimulating the transcription of the fibronectin gene in lung fibroblasts. Constitutive and nicotine-stimulated fibronectin expression was blocked in a dose-dependent manner by FP through inhibition of phosphorylation and DNA binding by the transcription factor CREB. Overall, we speculate that this mechanism may partially explain the beneficial effects of corticosteroids on tobacco-related obstructive lung disease.


   Footnotes
 
Abbreviations: AP = activator protein; bp = base-pair; cAMP = cyclic adenosine monophosphate; CREB = cyclic adenosine monophosphate response element binding protein; DMEM = Dulbecco modified Eagle medium; EDTA = ethylenediamine tetra-acetic acid; FBS = fetal bovine serum; FP = fluticasone propionate; GAPDH = glyceraldehyde 3-phosphate dehydrogenase; MMP = matrix metalloproteinase; mRNA = messenger RNA; PBS = phosphate-buffered saline solution; PCR = polymerase chain reaction; SDS = sodium dodecysulfate

A portion of this work was supported by a grant from Sepracor, Inc., and by a Merit Review Grant from the Department of Veterans Affairs to Dr. Roman.

Received for publication April 21, 2004. Accepted for publication August 19, 2004.


   References
TOP
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bartecchi, C, MacKenzie, T, Schrier, R (1994) The human cost of tobacco use. N Engl J Med 330,975-980[Free Full Text]
  2. Petty, TL COPD in perspective. Chest 2002;121,116S-120S[Abstract/Free Full Text]
  3. Global initiative for asthma. Bethesda, MD: National Institutes for Health, National Heart, Lung and Blood Institute, 1996; publication No. 95–3659
  4. Vanacker, NJ, Palmans, E, Kips, JC, et al Fluticasone inhibits but does not reverse allergen-induced structural airway changes. Am J Respir Crit Care Med 2001;163,674-679[Abstract/Free Full Text]
  5. Vanacker, NJ, Palmans, E, Pauwels, RA, et al Fluticasone inhibits the progression of allergen-induced structural airway changes. Clin Exp Allergy 2002;32,914-920[CrossRef][ISI][Medline]
  6. Villiger, B, Broekelmann, T, Kelley, D, et al Bronchoalveolar fibronectin in smokers and nonsmokers. Am Rev Respir Dis 1981;124,652-654[ISI][Medline]
  7. Vignola, AM, Chanez, P, Chiaparra, G, et al Release of transforming growth factor-ß (TGF-ß) and fibronectin by alveolar macrophages in airway diseases. Clin Exp Immunol 1996;106,114-119[CrossRef][ISI][Medline]
  8. Song, WD, Zhang, AC, Pang, YY, et al Fibronectin and hyaluronon in bronchoalveolar lavage fluid from young patients with chronic obstructive pulmonary disease. Respiration 1995;62,125-129[ISI][Medline]
  9. James, AL, Pare, PD, Hogg, JC, et al The mechanics of airway narrowing in asthma. Am Rev Respir Dis 1989;139,242-246[ISI][Medline]
  10. Brewster, CE, Howarth, PH, Djukanovic, R, et al Myofibroblasts and subepithelial fibrosis in bronchial asthma. Am J Respir Cell Mol Biol 1990;3,507-511
  11. Roche, WR, Beasley, R, Williams, JH, et al Subepithelial fibrosis in the bronchi of asthmatics. Lancet 1989;1,520-524[CrossRef][ISI][Medline]
  12. Michaelson, JE, Ritzenthaler, JD, Roman, J Regulation of serum-induced fibronectin expression by protein kinases, cytoskeletal integrity, and CREB. Am J Physiol Lung Cell Mol Physiol 2002;282,L291-L231[Abstract/Free Full Text]
  13. Bradford, MM A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72,248-254[CrossRef][ISI][Medline]
  14. Svetic, A, Finkleman, FD, Jain, YC, et al Cytokine gene expression after in vivo primary immunization with goat antibody to mouse IgD antibody. J Clin Immunol 1991;147,2391-2397
  15. Wynn, TA, Eltown, I, Cheeves, AW, et al Analysis of cytokine mRNA expression during primary granuloma formation induced by eggs of Schistosma mansoni. J Immunol 1993;151,1430-1440[Abstract]
  16. Perez, RL, Roman, J, Roser, S, et al Cytokine message and protein expression during lung granuloma formation and resolution induced by the mycobacterial cord factor trehalose-6,6'-dimycolate. J Interferon Cytokine Res 2000;20,795-804[CrossRef][ISI][Medline]
  17. Livak, KJ, Schmittgen, TD Analysis of relative gene expression data using real-time quantitative PCR and the 2-{Delta}{Delta}CT method. Methods 2001;25,402-408[CrossRef][ISI][Medline]
  18. Dean, DC, Bowlus, CL, Bourgeois, S Cloning and analysis of the promoter region of the human fibronectin gene. Proc Natl Acad Sci U S A 1987;84,1876-1880[Abstract/Free Full Text]
  19. Dignam, JD, Lebovitz, RM, Roeder, RG Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 1983;11,1475-1489[Abstract/Free Full Text]
  20. Ritzenthaler, JD, Roman, J Differential effects of protein kinase C inhibitors on fibronectin-induced interleukin-1ß gene transcription, protein synthesis and secretion in human monocytic cells. Immunology 1998;95,264-271[CrossRef][ISI][Medline]
  21. Gould, MC Endotoxin in vertebrate cell culture: its measurement and significance. Gould, MC eds. Uses and standardization of vertebrate cell cultures 1984,125-136 Associates of Cape Cod. Woods Hole, MA:
  22. Roman, J, Ritzenthaler, JD, Gil-Acosta, A, et al Nicotine and fibronectin expression in lung fibroblasts: implications for tobacco-related lung tissue remodeling. FASEB J 2004;18,1436-1438[Abstract/Free Full Text]
  23. Sutherland, ER, Allmers, H, Ayas, NT, et al Inhaled corticosteroids reduce progression of airflow limitation in chronic obstructive pulmonary disease: a meta-analysis. Thorax 2003;58,937-941[Abstract/Free Full Text]
  24. Dompeling, E, Van Schayck, CP, Molema, J, et al Inhaled beclomethasone improves the course of asthma and COPD. Eur Respir J 1992;5,945-952[Abstract]
  25. Barnes, PJ, Adcock, IM How do corticosteroids work in asthma? Ann Intern Med 2003;139,359-370[Free Full Text]
  26. Cronstein, BN, Kimmel, SC, Levin, RI, et al A mechanism for the antiinflammatory effects of corticosteroids: the glucocorticoid receptor regulates leukocyte adhesion to endothelial cells and expression of endothelial-adhesion molecule 1 and intracellular adhesion molecule 1. Proc Natl Acad Sci U S A 1992;89,9991-9995[Abstract/Free Full Text]
  27. Vanacker, NJ, Palmans, E, Pauwels, RA, et al Dose-related effect of inhaled fluticasone on allergen-induced airway changes in rats. Eur Respir J 2002;20,873-879[Abstract/Free Full Text]
  28. Blyth, DI, Tsumi, F, Wharton, MS, et al Airway subepithelial fibrosis in murine model of atopic asthma: suppression by dexamethasone or anti-interleukin-5 antibody. Am J Respir Cell Mol Biol 2000;23,241-246[Abstract/Free Full Text]
  29. Chetta, A, Zanini, A, Foresi, A, et al Vascular component of airway remodeling in asthma is reduced by high dose of fluticasone. Am J Respir Crit Care Med 2003;167,751-757[Abstract/Free Full Text]
  30. Hoshino, M, Nakamura, Y, Sim, JJ, et al Inhaled corticosteroid reduced lamina reticularis of the basement membrane by modulation of insulin-like growth factor (IGF)-I expression in bronchial asthma. Clin Exp Allergy 1998;28,568-577[CrossRef][ISI][Medline]
  31. Olivieri, D, Chetta, A, Del Donno, M, et al Effect of short-term treatment with low-dose inhaled fluticasone propionate on airway inflammation and remodeling in mild asthma: a placebo-controlled study. Am J Respir Crit Care Med 1997;155,1864-1871[Abstract]
  32. Sont, JK, Willems, LN, Bel, EH, et al Clinical control and histopathologic outcome of asthma when using airway hyperresponsiveness as an additional guide to long-term treatment. Am J Respir Crit Care Med 1999;159,1043-1051[Abstract/Free Full Text]
  33. Fowler, AA, Hyers, TM, Fisher, BJ, et al The adult respiratory distress syndrome: cell populations and soluble mediators in the air spaces of patients at high risk. Am Rev Respir Dis 1987;136,1225-1231[ISI][Medline]
  34. Shull, S, Meisler, N, Absher, M, et al Glucocorticoid-induced down regulation of transforming growth factor-ß1 in adult rat lung fibroblasts. Lung 1995;173,71-78[ISI][Medline]
  35. Bandi, N, Kompella, UB Budesonide reduces vascular endothelial growth factor secretion and expression in airway (Calu-1) and alveolar (A549) epithelial cells. Eur J Pharmacol 2001;425,109-116[CrossRef][ISI][Medline]
  36. Spoelstra, FM, Postma, DS, Hovenga, H, et al Additive anti-inflammatory effect of formoterol and budesonide on human lung fibroblasts. Thorax 2002;57,237-241[Abstract/Free Full Text]
  37. Van de Stolpe, A, Caldenhoven, E, Raaijmakers, JA, et al Glucocorticoid-mediated repression of intercellular adhesion molecule-1 expression in human monocytic and bronchial epithelial cell lines. Am J Respir Cell Mol Biol 1993;8,340-347
  38. Hoshino, M, Takahashi, M, Takai, Y, et al Inhaled corticosteroids decrease subepithelial collagen deposition by modulation of the balance between matrix meyalloproteinase-9 and tissue inhibitor of metalloproteinase-1 expression in asthma. J Allergy Clin Immunol 1999;104,356-363[CrossRef][ISI][Medline]
  39. Imai, K, Dalal, SS, Chen, ES, et al Human collagenase (matrix metalloproteinase-1) expression in the lungs of patients with emphysema. Am J Respir Crit Care Med 2001;163,786-791[Abstract/Free Full Text]
  40. Wang, ZL, Walker, BA, Weir, TD, et al The effect of chronic antigen and ß2-agonist exposure on airway remodeling in guinea pigs. Am J Respir Crit Care Med 1995;152,2097-2104[Abstract]
  41. Vanacker, NJ, Palmans, E, Pauwels, RA, et al Effect of combining salmeterol and fluticasone on the progression of airway remodeling. Am J Respir Crit Care Med 2002;166,1128-1134[Abstract/Free Full Text]
  42. Peters, MJ, Adcock, IM, Brown, CR, et al ß-Adrenoreceptor agonists interfere with glucocorticoid receptor DNA binding in rat lung. Eur J Pharmacol 1995;289,275-281[CrossRef][ISI][Medline]
  43. Dong, Y, Aronsson, M, Gustafsson, JA, et al The mechanism of cAMP-induced glucocorticoid receptor expression: correlation to cellular glucocorticoid response. J Biol Chem 1989;264,13679-13683[Abstract/Free Full Text]
  44. Nguyen, VT, Arredondo, J, Chernyavsky, AI, et al Pemphigus vulgaris IgG and methylprednisolone exhibit reciprocal effects on keratinocytes. J Biol Chem 2004;279,2135-2146[Abstract/Free Full Text]
  45. Kumagai, Y, Mizukado, S, Nagafune, J, et al Post-transcriptional elevation of mouse brain Mn-SOD protein by mercuric chloride. Brain Res 1997;769,178-182[CrossRef][ISI][Medline]
  46. Campagnoni, AT, Verdi, JM, Verity, AN, et al Posttranscriptional regulation of myelin protein gene expression. Ann N Y Acad Sci 1991;633,178-188[Abstract]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
J. Roman, H. N. Rivera, S. Roser-Page, S. V. Sitaraman, and J. D. Ritzenthaler
Adenosine induces fibronectin expression in lung epithelial cells: implications for airway remodeling
Am J Physiol Lung Cell Mol Physiol, February 1, 2006; 290(2): L317 - L325.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Article Archive
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tomic, R.
Right arrow Articles by Roman, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tomic, R.
Right arrow Articles by Roman, J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS